3' UTR signals necessary for expression of the Plasmodium gallinaceum ookinete protein, Pgs28, share similarities with those of yeast and plants

Molecular and Biochemical Parasitology
Helen CannLinnie M Golightly

Abstract

During metazoan development, 3' UTR signals mediate the time and place of gene expression. For protozoan Plasmodium parasites, the formation of ookinetes from gametes in the mosquito midgut is an analogous developmental process. Previous studies of the 3' UTR signals necessary for expression of Pgs28, the major surface protein of Plasmodium gallinaceum ookinetes, suggested that a 3' UTR T-rich region and DNA sequences containing an ATTAAA eukaryotic polyadenylation consensus motif were necessary for its expression. During metazoan development, U-rich elements may function in conjunction with eukaryotic polyadenylation consensus signals to mediate developmental protein expression. To define whether the putative Plasmodium elements were mediators of Pgs28 expression mutations of these nucleotide sequences were made in plasmid constructs. The effect of the mutations on Pgs28 expression was tested by the transient gene transfection of sexual stage P. gallinaceum parasites. These studies reveal that two different mutations of the ATTAAA motif, which alter gene expression in higher eukaryotes and yeast, do not alter the expression of Pgs28. However, the U-rich element, adjacent nucleotides UUUACAAAAUUGUUUUAACU and downstream nucleoti...Continue Reading

References

Jun 11, 1992·Nucleic Acids Research·M J van den HoffW H Lamers
Nov 1, 1995·Molecular and Cellular Biology·Z Guo, F Sherman
May 1, 1995·Current Biology : CB·J D Vassalli, A Stutz
Jun 1, 1995·Current Opinion in Cell Biology·C J Decker, R Parker
Apr 21, 1995·Cell·D CurtisP D Zamore
Jan 4, 1994·Proceedings of the National Academy of Sciences of the United States of America·S Irniger, G H Braus
Jun 1, 1993·Proceedings of the National Academy of Sciences of the United States of America·R GoonewardeneD Wirth
Oct 1, 1996·Plant Molecular Biology·H M Rothnie
Jan 1, 1997·Critical Reviews in Eukaryotic Gene Expression·B Stebbins-Boaz, J D Richter
Jun 27, 1998·Seminars in Cell & Developmental Biology·E B Goodwin, T C Evans
Aug 6, 1998·The Journal of Endocrinology·D A Day, M F Tuite
Nov 6, 1998·Molecular and Biochemical Parasitology·P HorrocksM Lanzer
Nov 26, 1999·Proceedings of the National Academy of Sciences of the United States of America·J H GraberT F Smith
Dec 29, 1999·Molecular and Biochemical Parasitology·L M GolightlyD F Wirth
Mar 15, 2001·Proceedings of the National Academy of Sciences of the United States of America·C K Ho, S Shuman
Jul 4, 2001·Nature Reviews. Molecular Cell Biology·R Mendez, J D Richter
Apr 9, 2002·Nucleic Acids Research·Joel H GraberTemple F Smith
Sep 12, 2002·Plant Physiology·Q. Li, A. G. Hunt
Oct 9, 2002·Nature·Jessica C KissingerDavid S Roos
Jun 26, 2003·Nucleic Acids Research·Michael Zuker

❮ Previous
Next ❯

Citations

Dec 27, 2008·Molecular and Biochemical Parasitology·Paul HorrocksRichard D Emes
Sep 24, 2004·Molecular and Biochemical Parasitology·Peter ShueLinnie M Golightly
Jan 28, 2006·Molecular and Biochemical Parasitology·Raphael M OguaririLinnie M Golightly
Jun 18, 2016·Parasitology International·Pavitra N RaoGunnar R Mair
Aug 31, 2018·PloS One·Ashley T StevensArthur G Hunt

❮ Previous
Next ❯

Related Concepts

Trending Feeds

COVID-19

Coronaviruses encompass a large family of viruses that cause the common cold as well as more serious diseases, such as the ongoing outbreak of coronavirus disease 2019 (COVID-19; formally known as 2019-nCoV). Coronaviruses can spread from animals to humans; symptoms include fever, cough, shortness of breath, and breathing difficulties; in more severe cases, infection can lead to death. This feed covers recent research on COVID-19.

Blastomycosis

Blastomycosis fungal infections spread through inhaling Blastomyces dermatitidis spores. Discover the latest research on blastomycosis fungal infections here.

Nuclear Pore Complex in ALS/FTD

Alterations in nucleocytoplasmic transport, controlled by the nuclear pore complex, may be involved in the pathomechanism underlying multiple neurodegenerative diseases including Amyotrophic Lateral Sclerosis and Frontotemporal Dementia. Here is the latest research on the nuclear pore complex in ALS and FTD.

Applications of Molecular Barcoding

The concept of molecular barcoding is that each original DNA or RNA molecule is attached to a unique sequence barcode. Sequence reads having different barcodes represent different original molecules, while sequence reads having the same barcode are results of PCR duplication from one original molecule. Discover the latest research on molecular barcoding here.

Chronic Fatigue Syndrome

Chronic fatigue syndrome is a disease characterized by unexplained disabling fatigue; the pathology of which is incompletely understood. Discover the latest research on chronic fatigue syndrome here.

Evolution of Pluripotency

Pluripotency refers to the ability of a cell to develop into three primary germ cell layers of the embryo. This feed focuses on the mechanisms that underlie the evolution of pluripotency. Here is the latest research.

Position Effect Variegation

Position Effect Variagation occurs when a gene is inactivated due to its positioning near heterochromatic regions within a chromosome. Discover the latest research on Position Effect Variagation here.

STING Receptor Agonists

Stimulator of IFN genes (STING) are a group of transmembrane proteins that are involved in the induction of type I interferon that is important in the innate immune response. The stimulation of STING has been an active area of research in the treatment of cancer and infectious diseases. Here is the latest research on STING receptor agonists.

Microbicide

Microbicides are products that can be applied to vaginal or rectal mucosal surfaces with the goal of preventing, or at least significantly reducing, the transmission of sexually transmitted infections. Here is the latest research on microbicides.