A Chinese patient with 11β-hydroxylase deficiency due to novel compound heterozygous mutation in CYP11B1 gene: a case report

BMC Endocrine Disorders
Xianxian YuanZhaolin Lu

Abstract

Congenital adrenal hyperplasia (CAH) resulting from steroid 11β-hydroxylase deficiency (11β-OHD) is caused by mutations in the CYP11B1 gene. It is the second major form of CAH associated with hypertension and hypopotassemia. The aim of this study was to provide a genetic analysis of 11β-OHD in a Chinese family. A 19-year-old Chinese man was clinically diagnosed with 11β-OHD. His initial clinical manifestations included precocious puberty, hyperpigmentation, hypertension, and hypopotassemia. The patient had taken an overdose of dexamethasone (0.75 mg/d) for more than 10 years before finally developing iatrogenic Cushing's syndrome. Our aim was to perform a molecular diagnosis of his family. Mutations in the CYP11B1 gene of the patient and his parents were examined using polymerase chain reaction (PCR) resequencing. Additionally, to predict the possible effects of novel mutations on the structure and function of 11β-hydroxylase, these mutations were analyzed by MutationTaster software. Two novel pathogenic mutations were found in the CYP11B1 gene: a heterozygous in-frame insertion deletion mutation c.1440_1447delinsTAAAAG in exon 9 inherited from the father and a heterozygous mutation c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC (p....Continue Reading

References

Nov 30, 1990·Biochemical and Biophysical Research Communications·T KawainotoK Nakao
Oct 1, 1987·Proceedings of the National Academy of Sciences of the United States of America·S C ChuaP C White
Aug 1, 1994·Endocrine Reviews·P C WhiteL Pascoe
May 15, 1993·Proceedings of the National Academy of Sciences of the United States of America·K M CurnowL Pascoe
Aug 1, 1996·The Journal of Clinical Endocrinology and Metabolism·S GeleyR Kofler
May 10, 2001·Endocrinology and Metabolism Clinics of North America·P C White
Dec 18, 2001·Journal of Inorganic Biochemistry·N V BelkinaR Bernhardt
Nov 13, 2002·Seminars in Reproductive Medicine·Michael Peter
Aug 22, 2003·The New England Journal of Medicine·Phyllis W Speiser, Perrin C White
Jun 21, 2005·Lancet·Deborah P Merke, Stefan R Bornstein
Feb 26, 2008·Trends in Endocrinology and Metabolism : TEM·Saroj Nimkarn, Maria I New
Jul 2, 2009·The Journal of Clinical Endocrinology and Metabolism·Fernanda C SoardiMaricilda P de Mello
Jan 3, 2012·General and Comparative Endocrinology·Ilhem Ben CharfeddineMoez Gribaa
Sep 12, 2012·The Journal of Steroid Biochemistry and Molecular Biology·Manna ZhangXiaoying Li
Feb 24, 2017·Proceedings of the National Academy of Sciences of the United States of America·Ahmed KhattabMaria I New

❮ Previous
Next ❯

Citations

Sep 20, 2019·International Journal of Molecular Sciences·Federico BaronioAntonio Balsamo
Aug 28, 2019·Hormone Research in Pædiatrics·Zeynep AtayAbdullah Bereket

❮ Previous
Next ❯

Methods Mentioned

BETA
PCR
electrophoresis
Assay

Software Mentioned

MutationTaster
SeqMan

Related Concepts

Trending Feeds

COVID-19

Coronaviruses encompass a large family of viruses that cause the common cold as well as more serious diseases, such as the ongoing outbreak of coronavirus disease 2019 (COVID-19; formally known as 2019-nCoV). Coronaviruses can spread from animals to humans; symptoms include fever, cough, shortness of breath, and breathing difficulties; in more severe cases, infection can lead to death. This feed covers recent research on COVID-19.

Blastomycosis

Blastomycosis fungal infections spread through inhaling Blastomyces dermatitidis spores. Discover the latest research on blastomycosis fungal infections here.

Nuclear Pore Complex in ALS/FTD

Alterations in nucleocytoplasmic transport, controlled by the nuclear pore complex, may be involved in the pathomechanism underlying multiple neurodegenerative diseases including Amyotrophic Lateral Sclerosis and Frontotemporal Dementia. Here is the latest research on the nuclear pore complex in ALS and FTD.

Applications of Molecular Barcoding

The concept of molecular barcoding is that each original DNA or RNA molecule is attached to a unique sequence barcode. Sequence reads having different barcodes represent different original molecules, while sequence reads having the same barcode are results of PCR duplication from one original molecule. Discover the latest research on molecular barcoding here.

Chronic Fatigue Syndrome

Chronic fatigue syndrome is a disease characterized by unexplained disabling fatigue; the pathology of which is incompletely understood. Discover the latest research on chronic fatigue syndrome here.

Evolution of Pluripotency

Pluripotency refers to the ability of a cell to develop into three primary germ cell layers of the embryo. This feed focuses on the mechanisms that underlie the evolution of pluripotency. Here is the latest research.

Position Effect Variegation

Position Effect Variagation occurs when a gene is inactivated due to its positioning near heterochromatic regions within a chromosome. Discover the latest research on Position Effect Variagation here.

STING Receptor Agonists

Stimulator of IFN genes (STING) are a group of transmembrane proteins that are involved in the induction of type I interferon that is important in the innate immune response. The stimulation of STING has been an active area of research in the treatment of cancer and infectious diseases. Here is the latest research on STING receptor agonists.

Microbicide

Microbicides are products that can be applied to vaginal or rectal mucosal surfaces with the goal of preventing, or at least significantly reducing, the transmission of sexually transmitted infections. Here is the latest research on microbicides.