Jul 10, 2016

Allelic spectrum of the RNA guided CRISPR/Cas9 DNA repair events at PAM associated trinucleotide repeat (NGG)n in Caenorhabditis elegans

BioRxiv : the Preprint Server for Biology
Wadim J Kapulkin

Abstract

This work describes the experience with implementation of Streptococcus pyogenes Cas9 nuclease, expressed in C. elegans germline. The described work utilizes guide RNA-unc- 22-1000 (GGAGAAGGAGGCGGTGCTGG) designed to target the polyglycine encoding stretch within the unc-22 gene embedding the impure trinucleotide (NGG)n PAM repeat region. We describe the allelic spectrum of mutational events identified at position specified by gRNA-unc-22-1000. Of above experiments we conclude: i. the trinucleotide (NGG)n PAM repeat is a receptive target for the CRISPR/Cas9 manipulations in C. elegans ii. we conclude the allelic spectrum indicates the gRNA-unc-22-1000 induces fairly frequent NHEJ joining events involving deletions and indels but also, a phenotypically distinct class of small in-frame deletions indicative for microhomology mediated end-joining (MMEJ) as a result of S. pyogenes Cas9 activity at the trinucleotide(NGG)n PAM repeat region. We demonstrate guide RNA-unc-22-1000 could be used to modify complex transgenic C. elegans line expressing human beta-amyloid protein. We provide the evidence for bi-allelic transaction resulting from Cas9 action recovered in experiment in CB1138 him-6 background. We contrast the expected performan...Continue Reading

  • References
  • Citations

References

  • We're still populating references for this paper, please check back later.
  • References
  • Citations

Citations

  • This paper may not have been cited yet.

Mentioned in this Paper

Calcinus elegans
Cyartonema elegans
Coleonyx elegans
Non-Homologous DNA End-Joining
Positioning Attribute
Cestrum elegans
Clarkia unguiculata
Clathrulina elegans
Cardioglossa elegans
Cymbella elegans

About this Paper

Related Feeds

CRISPR for Genome Editing

Genome editing technologies enable the editing of genes to create or correct mutations. Clustered regularly interspaced short palindromic repeats (CRISPR) are DNA sequences in the genome that are recognized and cleaved by CRISPR-associated proteins (Cas). Here is the latest research on the use of CRISPR-Cas system in gene editing.

Alzheimer's Disease: Genes&Microglia (Preprints)

Genes and microglia are associated with the risk of developing and the progression of conditions such as Alzheimer's Disease (AD). Here are the latest preprints pertaining to this disease.

CRISPR (general)

Clustered regularly interspaced short palindromic repeats (CRISPR) are DNA sequences in the genome that are recognized and cleaved by CRISPR-associated proteins (Cas). CRISPR-Cas system enables the editing of genes to create or correct mutations. Discover the latest research on CRISPR here.

BioRxiv & MedRxiv Preprints

BioRxiv and MedRxiv are the preprint servers for biology and health sciences respectively, operated by Cold Spring Harbor Laboratory. Here are the latest preprint articles (which are not peer-reviewed) from BioRxiv and MedRxiv.

CRISPR Ribonucleases Deactivation

CRISPR-Cas system enables the editing of genes to create or correct mutations. This feed focuses on mechanisms that underlie deactivation of CRISPR ribonucleases. Here is the latest research.

CRISPR Genome Editing & Therapy (Preprints)

CRISPR-Cas system enables the editing of genes to create or correct mutations. This feed focuses on the application of this system for gene editing and therapy in human diseases.

CRISPR for Genome Editing (Preprints)

Genome editing technologies enable the editing of genes to create or correct mutations. Clustered regularly interspaced short palindromic repeats (CRISPR) are DNA sequences in the genome that are recognized and cleaved by CRISPR-associated proteins (Cas). Here are the latest preprints on the use of CRISPR-Cas system in gene editing.

Alzheimer's Disease: RNA Regulation

RNA regulation involves several mechanisms that are used by cells to decreases or increase the production of RNA. Issues with RNA regulation are associated with Alzheimer's Disease (AD). Here are the latest discoveries pertaining to RNA regulation and this disease.

Related Papers

Nature Reviews. Molecular Cell Biology
Eytan Zlotorynski
Methods in Molecular Biology
Scott J GratzKate M O'Connor-Giles
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics
Zhanhui Ou, Xiaofang Sun
© 2020 Meta ULC. All rights reserved