Binding of l-Argininamide to a DNA Aptamer: A Volumetric Study

The Journal of Physical Chemistry. B
Lutan LiuTigran V Chalikian

Abstract

We use a combination of volumetric and spectroscopic techniques to characterize the binding of l-argininamide to its aptamer, the 24-base DNA hairpin 5'-d(GATCGAAACGTAGCGCCTTCGATC)-3'. The binding causes increases in volume, Δ V, and adiabatic compressibility, Δ KS, of 12 ± 7 cm3 mol-1 bar and (73 ± 8) × 10-4 cm3 mol-1 bar-1, respectively. These volumetric results combined with structural data reveal that the binding is accompanied by release of 73 ± 27 waters from the hydration shells of the interacting molecules to the bulk. We use the estimated change in hydration to estimate the hydration, Δ Shyd, and configurational, Δ Sconf, contributions to the binding entropy. The large and unfavorable change in configurational entropy, Δ Sconf, is nearly compensated by a favorable change in the hydration contribution, Δ Shyd.

References

Jan 1, 1977·Annual Review of Biophysics and Bioengineering·F M Richards
Aug 1, 1976·Proceedings of the National Academy of Sciences of the United States of America·A Cooper
Aug 30, 1990·Nature·A D Ellington, J W Szostak
Jan 1, 1991·Annual Review of Biophysics and Biophysical Chemistry·A P Sarvazyan
Aug 1, 1973·The Review of Scientific Instruments·F Eggers, T Funck
Jan 1, 1984·Progress in Biophysics and Molecular Biology·A Cooper
Jan 1, 1995·Advances in Protein Chemistry·G I Makhatadze, P L Privalov
Dec 1, 1996·Nature Structural Biology·C H Lin, D J Patel
Oct 2, 1998·FEBS Letters·J L MergnyL Lacroix
May 2, 2002·Biochimica Et Biophysica Acta·Nicolas Taulier, Tigran V Chalikian
Jan 25, 2003·Annual Review of Biophysics and Biomolecular Structure·Tigran V Chalikian
Jul 25, 2003·Biophysical Chemistry·Tigran V Chalikian, Rana Filfil
Mar 18, 2004·Oligonucleotides·Jean-Louis Mergny, Laurent Lacroix
Aug 18, 2006·Biophysical Chemistry·G Reid BishopJonathan B Chaires
Oct 31, 2007·Methods : a Companion to Methods in Enzymology·Phillip A Rachwal, Keith R Fox
Jan 19, 2008·Biophysical Chemistry·Andrey V TataurovRichard Owczarzy
Oct 24, 2009·Physical Chemistry Chemical Physics : PCCP·Po-Hsun LinWen-Yih Chen
Jul 20, 2010·Current Opinion in Pharmacology·David H J BunkaPeter G Stockley
Dec 3, 2011·Biophysical Chemistry·Nisha PatelTigran V Chalikian
Jun 27, 2012·Biochemistry·Ikbae SonTigran V Chalikian
Oct 12, 2013·Biophysical Chemistry·Austin D VogtEnrico Di Cera
Feb 20, 2014·Journal of the American Chemical Society·Ikbae SonTigran V Chalikian
Jan 7, 2015·Chemical Society Reviews·Haitao MaYuan Wan
Apr 9, 2016·Biophysical Chemistry·Henry S AshbaughHayden E Houser
Nov 4, 2016·Nature Reviews. Drug Discovery·Jiehua Zhou, John Rossi
Jan 1, 2015·Molecular Therapy. Nucleic Acids·Michael Blind, Michael Blank
May 13, 2017·Biochemistry·Pradipta Chakraborty, Enrico Di Cera

❮ Previous
Next ❯

Citations

Aug 28, 2021·Biology·Tigran V Chalikian, Robert B Macgregor

❮ Previous
Next ❯

Related Concepts

Trending Feeds

COVID-19

Coronaviruses encompass a large family of viruses that cause the common cold as well as more serious diseases, such as the ongoing outbreak of coronavirus disease 2019 (COVID-19; formally known as 2019-nCoV). Coronaviruses can spread from animals to humans; symptoms include fever, cough, shortness of breath, and breathing difficulties; in more severe cases, infection can lead to death. This feed covers recent research on COVID-19.

Blastomycosis

Blastomycosis fungal infections spread through inhaling Blastomyces dermatitidis spores. Discover the latest research on blastomycosis fungal infections here.

Nuclear Pore Complex in ALS/FTD

Alterations in nucleocytoplasmic transport, controlled by the nuclear pore complex, may be involved in the pathomechanism underlying multiple neurodegenerative diseases including Amyotrophic Lateral Sclerosis and Frontotemporal Dementia. Here is the latest research on the nuclear pore complex in ALS and FTD.

Applications of Molecular Barcoding

The concept of molecular barcoding is that each original DNA or RNA molecule is attached to a unique sequence barcode. Sequence reads having different barcodes represent different original molecules, while sequence reads having the same barcode are results of PCR duplication from one original molecule. Discover the latest research on molecular barcoding here.

Chronic Fatigue Syndrome

Chronic fatigue syndrome is a disease characterized by unexplained disabling fatigue; the pathology of which is incompletely understood. Discover the latest research on chronic fatigue syndrome here.

Evolution of Pluripotency

Pluripotency refers to the ability of a cell to develop into three primary germ cell layers of the embryo. This feed focuses on the mechanisms that underlie the evolution of pluripotency. Here is the latest research.

Position Effect Variegation

Position Effect Variagation occurs when a gene is inactivated due to its positioning near heterochromatic regions within a chromosome. Discover the latest research on Position Effect Variagation here.

STING Receptor Agonists

Stimulator of IFN genes (STING) are a group of transmembrane proteins that are involved in the induction of type I interferon that is important in the innate immune response. The stimulation of STING has been an active area of research in the treatment of cancer and infectious diseases. Here is the latest research on STING receptor agonists.

Microbicide

Microbicides are products that can be applied to vaginal or rectal mucosal surfaces with the goal of preventing, or at least significantly reducing, the transmission of sexually transmitted infections. Here is the latest research on microbicides.