Characterization of an avian infectious bronchitis virus isolated in China from chickens with nephritis

Journal of Veterinary Medicine. B, Infectious Diseases and Veterinary Public Health
J-Y ZhouL-Q Cheng

Abstract

One IBV isolate, SC021202, was isolated from the kidneys of the infected young chickens by inoculating embryonated eggs, and its morphology, physiochemical and haemagglutonating properties were detected. Virulence of the isolate SC021202 was determined with specific pathogen-free (SPF) chicken inoculation. Nucleotide acid sequence of S1 gene of the isolate SC021202 was further sequenced and analysed. The physiochemical and morphological properties of the isolate SC021202 were in accordance to that of typical infectious bronchitis virus (IBV). In a pathogenicity experiment, the clinical signs and related gross lesions resembling those of field outbreak were reproduced and the virus isolate SC021202 was re-isolated from the kidneys of the infected chicken. Sequence data demonstrated that the full length of the amplified S1 gene of the isolate SC021202 was composed of 1931 nucleotides, coding a polypeptide of 543 amino acid residues. Compared with IBV strains from GenBank, the nucleotide and deduced amino acid sequence of S1 gene of the isolate SC021202 shared 60.0-91.4% and 49.1-88.9% identities, respectively. A nucleotide fragment of 'CTTTTTAATTATACTAACGGA' was inserted at nucleotide site 208 in the S1 gene of the isolate. These...Continue Reading

References

Mar 1, 1989·Virology·J G KustersB A van der Zeijst
Jan 1, 1987·The Journal of General Virology·M E BoursnellM M Binns
Feb 1, 1987·The Journal of General Virology·J G KustersB A Van der Zeijst
Dec 1, 1984·Poultry Science·R W Winterfield, M A Albassam
Jan 1, 1986·Avian Pathology : Journal of the W.V.P.A·M El-HouadfiA G Ambali
Jan 1, 1977·Avian Pathology : Journal of the W.V.P.A·D J Alexander, N J Chettle

❮ Previous
Next ❯

Citations

Oct 16, 2010·Avian Diseases·Kylie A HewsonAmir H Noormohammadi
Sep 23, 2006·Avian Pathology : Journal of the W.V.P.A·Yury A BochkovVladimir V Drygin
Oct 19, 2011·Veterinary Microbiology·Shahid Hussain AbroClaudia Baule
Jul 25, 2009·The Journal of General Virology·Mariette F DucatezClaude P Muller
Sep 5, 2006·American Journal of Veterinary Research·Dong H QianGuo X Hua
Aug 21, 2012·Archives of Virology·Ahmed S Abdel-MoneimMagdy F El-Kady

❮ Previous
Next ❯

Datasets Mentioned

BETA
M85244
AF027509
U77298
X52084
AF036937
Florida
18288
AF027512
AF352315
AF210735

Methods Mentioned

BETA
transmission electron microscopy
PCR

Software Mentioned

Clustal
DNAStar

Related Concepts

Trending Feeds

COVID-19

Coronaviruses encompass a large family of viruses that cause the common cold as well as more serious diseases, such as the ongoing outbreak of coronavirus disease 2019 (COVID-19; formally known as 2019-nCoV). Coronaviruses can spread from animals to humans; symptoms include fever, cough, shortness of breath, and breathing difficulties; in more severe cases, infection can lead to death. This feed covers recent research on COVID-19.

Blastomycosis

Blastomycosis fungal infections spread through inhaling Blastomyces dermatitidis spores. Discover the latest research on blastomycosis fungal infections here.

Nuclear Pore Complex in ALS/FTD

Alterations in nucleocytoplasmic transport, controlled by the nuclear pore complex, may be involved in the pathomechanism underlying multiple neurodegenerative diseases including Amyotrophic Lateral Sclerosis and Frontotemporal Dementia. Here is the latest research on the nuclear pore complex in ALS and FTD.

Applications of Molecular Barcoding

The concept of molecular barcoding is that each original DNA or RNA molecule is attached to a unique sequence barcode. Sequence reads having different barcodes represent different original molecules, while sequence reads having the same barcode are results of PCR duplication from one original molecule. Discover the latest research on molecular barcoding here.

Chronic Fatigue Syndrome

Chronic fatigue syndrome is a disease characterized by unexplained disabling fatigue; the pathology of which is incompletely understood. Discover the latest research on chronic fatigue syndrome here.

Evolution of Pluripotency

Pluripotency refers to the ability of a cell to develop into three primary germ cell layers of the embryo. This feed focuses on the mechanisms that underlie the evolution of pluripotency. Here is the latest research.

Position Effect Variegation

Position Effect Variagation occurs when a gene is inactivated due to its positioning near heterochromatic regions within a chromosome. Discover the latest research on Position Effect Variagation here.

STING Receptor Agonists

Stimulator of IFN genes (STING) are a group of transmembrane proteins that are involved in the induction of type I interferon that is important in the innate immune response. The stimulation of STING has been an active area of research in the treatment of cancer and infectious diseases. Here is the latest research on STING receptor agonists.

Microbicide

Microbicides are products that can be applied to vaginal or rectal mucosal surfaces with the goal of preventing, or at least significantly reducing, the transmission of sexually transmitted infections. Here is the latest research on microbicides.