First Report of Beet pseudo yellows virus in Blackberry in the United States

Plant Disease
I E Tzanetakis, R R Martin

Abstract

Blackberry (Rubus sp.) plants in Arkansas, North Carolina, and South Carolina during the last 3 years have shown symptoms typical of virus infection, including vein yellowing, line pattern, and mottle, and in certain cases, decline and death. All of the symptomatic plants used in our studies were infected with Blackberry yellow vein associated virus (BYVaV) (1). We cloned cDNA derived from dsRNA extracted from a symptomatic plant from South Carolina and identified two cDNA clones (approximate size of 700 and 900 bp, in addition to those that corresponded to a sequence of BYVaV) with sequences identical to the sequence (GenBank Accession No. AY 268107) of Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene. Total RNA extracts from the symptomatic plant were tested using reverse transcription-polymerase chain reaction (RT-PCR) with oligonucleotide primers BP CPm F (5' TTCATATTAAGGATGCGCAGA 3') and BP CPm R (5' TGAAAGATGTCCRCTAATGATA 3') that amplified a fragment of the minor coat protein (CPm) gene of BPYV. A PCR amplicon of the expected size (334 bp) was generated, and sequencing confirmed the results of the random cloning. We also detected the virus in a second blackberry plant from South Carolina with RT-PCR. T...Continue Reading

Citations

Sep 29, 2009·Archives of Virology·Sead Sabanadzovic, Nina Abou Ghanem-Sabanadzovic
Jul 8, 2011·Archives of Virology·Ioannis E TzanetakisJing Zhou
Jul 1, 2007·Plant Disease·James SusaimuthuRobert R Martin
Apr 1, 2006·Plant Disease·Robert R Martin, Ioannis E Tzanetakis

❮ Previous
Next ❯

Related Concepts

Trending Feeds

COVID-19

Coronaviruses encompass a large family of viruses that cause the common cold as well as more serious diseases, such as the ongoing outbreak of coronavirus disease 2019 (COVID-19; formally known as 2019-nCoV). Coronaviruses can spread from animals to humans; symptoms include fever, cough, shortness of breath, and breathing difficulties; in more severe cases, infection can lead to death. This feed covers recent research on COVID-19.

Blastomycosis

Blastomycosis fungal infections spread through inhaling Blastomyces dermatitidis spores. Discover the latest research on blastomycosis fungal infections here.

Nuclear Pore Complex in ALS/FTD

Alterations in nucleocytoplasmic transport, controlled by the nuclear pore complex, may be involved in the pathomechanism underlying multiple neurodegenerative diseases including Amyotrophic Lateral Sclerosis and Frontotemporal Dementia. Here is the latest research on the nuclear pore complex in ALS and FTD.

Applications of Molecular Barcoding

The concept of molecular barcoding is that each original DNA or RNA molecule is attached to a unique sequence barcode. Sequence reads having different barcodes represent different original molecules, while sequence reads having the same barcode are results of PCR duplication from one original molecule. Discover the latest research on molecular barcoding here.

Chronic Fatigue Syndrome

Chronic fatigue syndrome is a disease characterized by unexplained disabling fatigue; the pathology of which is incompletely understood. Discover the latest research on chronic fatigue syndrome here.

Evolution of Pluripotency

Pluripotency refers to the ability of a cell to develop into three primary germ cell layers of the embryo. This feed focuses on the mechanisms that underlie the evolution of pluripotency. Here is the latest research.

Position Effect Variegation

Position Effect Variagation occurs when a gene is inactivated due to its positioning near heterochromatic regions within a chromosome. Discover the latest research on Position Effect Variagation here.

STING Receptor Agonists

Stimulator of IFN genes (STING) are a group of transmembrane proteins that are involved in the induction of type I interferon that is important in the innate immune response. The stimulation of STING has been an active area of research in the treatment of cancer and infectious diseases. Here is the latest research on STING receptor agonists.

Microbicide

Microbicides are products that can be applied to vaginal or rectal mucosal surfaces with the goal of preventing, or at least significantly reducing, the transmission of sexually transmitted infections. Here is the latest research on microbicides.