First Report of Strawberry latent ringspot virus in Strawberry in the United States and Canada

Plant Disease
R R MartinJ F Elmhirst

Abstract

Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5' CCTCTCCAACC-TGCTAGACT 3') and SLRSV R (5' AAGCGCATGAAGGTGTAACT 3') that amplify a 497-bp fragment of RNA 2 of Strawberry latent ringspot virus (SLRSV) were developed and utilized for reverse transcription-polymerase chain reaction (RT-PCR) detection. SLRSV belongs to the family Sequiviridae and is transmitted by nematodes of the genus Xiphinema. The virus has a broad host range (4) and is usually symptomless in strawberries. Strawberry plants from commercial fields in California, Oregon, Washington, and British Columbia, Canada were tested. SLRSV was identified in 17% of plants tested from California and 4% of plants tested from British Columbia, while all samples from Oregon and Washington tested negative. The fragment amplified (GenBank Accession No. AY...Continue Reading

Citations

Apr 1, 2006·Plant Disease·Robert R Martin, Ioannis E Tzanetakis
May 1, 2013·Plant Disease·Joe TangGerard R G Clover
Jan 1, 2010·Plant Disease·Ioannis E TzanetakisRobert R Martin
Sep 2, 2020·Plant Disease·Josef ŠpakIoannis E Tzanetakis

❮ Previous
Next ❯

Related Concepts

Trending Feeds

COVID-19

Coronaviruses encompass a large family of viruses that cause the common cold as well as more serious diseases, such as the ongoing outbreak of coronavirus disease 2019 (COVID-19; formally known as 2019-nCoV). Coronaviruses can spread from animals to humans; symptoms include fever, cough, shortness of breath, and breathing difficulties; in more severe cases, infection can lead to death. This feed covers recent research on COVID-19.

Blastomycosis

Blastomycosis fungal infections spread through inhaling Blastomyces dermatitidis spores. Discover the latest research on blastomycosis fungal infections here.

Nuclear Pore Complex in ALS/FTD

Alterations in nucleocytoplasmic transport, controlled by the nuclear pore complex, may be involved in the pathomechanism underlying multiple neurodegenerative diseases including Amyotrophic Lateral Sclerosis and Frontotemporal Dementia. Here is the latest research on the nuclear pore complex in ALS and FTD.

Applications of Molecular Barcoding

The concept of molecular barcoding is that each original DNA or RNA molecule is attached to a unique sequence barcode. Sequence reads having different barcodes represent different original molecules, while sequence reads having the same barcode are results of PCR duplication from one original molecule. Discover the latest research on molecular barcoding here.

Chronic Fatigue Syndrome

Chronic fatigue syndrome is a disease characterized by unexplained disabling fatigue; the pathology of which is incompletely understood. Discover the latest research on chronic fatigue syndrome here.

Evolution of Pluripotency

Pluripotency refers to the ability of a cell to develop into three primary germ cell layers of the embryo. This feed focuses on the mechanisms that underlie the evolution of pluripotency. Here is the latest research.

Position Effect Variegation

Position Effect Variagation occurs when a gene is inactivated due to its positioning near heterochromatic regions within a chromosome. Discover the latest research on Position Effect Variagation here.

STING Receptor Agonists

Stimulator of IFN genes (STING) are a group of transmembrane proteins that are involved in the induction of type I interferon that is important in the innate immune response. The stimulation of STING has been an active area of research in the treatment of cancer and infectious diseases. Here is the latest research on STING receptor agonists.

Microbicide

Microbicides are products that can be applied to vaginal or rectal mucosal surfaces with the goal of preventing, or at least significantly reducing, the transmission of sexually transmitted infections. Here is the latest research on microbicides.