Identification of two CUL7 variants in two Chinese families with 3-M syndrome by whole-exome sequencing.

Journal of Clinical Laboratory Analysis
Li HuShengwen Huang

Abstract

3-M syndrome is a rare autosomal recessive disorder characterized by primordial growth retardation, large head circumference, characteristic facial features, and mild skeletal changes, which is associated with the exclusive variants in three genes, namely CUL7, OBSL1, and CCDC8. Only a few 3-M syndrome patients have been reported in Chinese population. Children with unexplained severe short stature, facial dysmorphism, and normal intelligence in two Chinese families and their relatives were enrolled. Trio-whole-exome sequencing (trio-WES) and pathogenicity prediction analysis were conducted on the recruited patients. A conservative analysis of the mutant amino acid sequences and function prediction analysis of the wild-type (WT) and mutant CUL7 protein were performed. We identified a homozygous missense variant (NM_014780.4: c.4898C > T, p.Thr1633Met) in CUL7 gene in a 6-month-old female infant from a non-consanguineous family, and a homozygous frameshift variant (NM_014780.4: c.3722_3749 dup GGCTGGCACAGCTGCAGCAATGCCTGCA, p. Val1252Glyfs*23) in CUL7 gene in two affected siblings from a consanguinity family. These two variants may affect the properties and structure of CUL7 protein. These two rare variants were observed in Chine...Continue Reading

References

Oct 23, 2001·Clinical Dysmorphology·G van der WalI van der Burgt
Aug 9, 2003·Proceedings of the National Academy of Sciences of the United States of America·Takehiro AraiJames A DeCaprio
Mar 17, 2004·Oncogene·Zhen-Qiang PanKenneth Wu
Feb 3, 2005·Nature Reviews. Molecular Cell Biology·Matthew D Petroski, Raymond J Deshaies
Sep 6, 2005·Nature Genetics·Céline HuberValérie Cormier-Daire
Oct 18, 2008·Cell Cycle·Antonio SarikasZhen-Qiang Pan
Mar 15, 2011·Best Practice & Research. Clinical Endocrinology & Metabolism·Céline HuberValerie Cormier-Daire
Sep 14, 2011·Journal of Clinical Research in Pediatric Endocrinology·Ayla Güven, Ayşe Nurcan Cebeci
Dec 14, 2011·Hormone Research in Pædiatrics·Dan HansonPeter E Clayton
Sep 29, 2012·Journal of Molecular Endocrinology·D HansonP E Clayton
Mar 23, 2013·Italian Journal of Pediatrics·Cristina MeazzaMauro Bozzola
Aug 1, 2013·European Journal of Human Genetics : EJHG·Muriel Holder-EspinasseValérie Cormier-Daire
May 6, 2014·Molecular Cell·Jun YanYue Xiong
May 7, 2015·Endocrinology, Diabetes & Metabolism Case Reports·A DeebA El Fatih
Jan 29, 2016·Scientific Reports·Huaying HuJia-Da Li
Feb 7, 2016·European Journal of Medical Genetics·Licia LugliAntonio Percesepe
Nov 1, 2016·Journal of Clinical Research in Pediatric Endocrinology·Melikşah KeskinSemra Çetinkaya
Oct 4, 2017·Clinica Chimica Acta; International Journal of Clinical Chemistry·Xuyun HuYiping Shen
Oct 31, 2018·Human Genome Variation·Tomozumi TakataniNaoki Shimojo

❮ Previous
Next ❯

Methods Mentioned

BETA
cesarean section
PCR
neddylation

Software Mentioned

Phyre2
PolyPhen
DNASTAR
MutationTaster
Picard MarkDuplicates
Primer
ANNOVAR
Chromas
SAMtools
Clustal Omega

Related Concepts

Trending Feeds

COVID-19

Coronaviruses encompass a large family of viruses that cause the common cold as well as more serious diseases, such as the ongoing outbreak of coronavirus disease 2019 (COVID-19; formally known as 2019-nCoV). Coronaviruses can spread from animals to humans; symptoms include fever, cough, shortness of breath, and breathing difficulties; in more severe cases, infection can lead to death. This feed covers recent research on COVID-19.

Blastomycosis

Blastomycosis fungal infections spread through inhaling Blastomyces dermatitidis spores. Discover the latest research on blastomycosis fungal infections here.

Nuclear Pore Complex in ALS/FTD

Alterations in nucleocytoplasmic transport, controlled by the nuclear pore complex, may be involved in the pathomechanism underlying multiple neurodegenerative diseases including Amyotrophic Lateral Sclerosis and Frontotemporal Dementia. Here is the latest research on the nuclear pore complex in ALS and FTD.

Applications of Molecular Barcoding

The concept of molecular barcoding is that each original DNA or RNA molecule is attached to a unique sequence barcode. Sequence reads having different barcodes represent different original molecules, while sequence reads having the same barcode are results of PCR duplication from one original molecule. Discover the latest research on molecular barcoding here.

Chronic Fatigue Syndrome

Chronic fatigue syndrome is a disease characterized by unexplained disabling fatigue; the pathology of which is incompletely understood. Discover the latest research on chronic fatigue syndrome here.

Evolution of Pluripotency

Pluripotency refers to the ability of a cell to develop into three primary germ cell layers of the embryo. This feed focuses on the mechanisms that underlie the evolution of pluripotency. Here is the latest research.

Position Effect Variegation

Position Effect Variagation occurs when a gene is inactivated due to its positioning near heterochromatic regions within a chromosome. Discover the latest research on Position Effect Variagation here.

STING Receptor Agonists

Stimulator of IFN genes (STING) are a group of transmembrane proteins that are involved in the induction of type I interferon that is important in the innate immune response. The stimulation of STING has been an active area of research in the treatment of cancer and infectious diseases. Here is the latest research on STING receptor agonists.

Microbicide

Microbicides are products that can be applied to vaginal or rectal mucosal surfaces with the goal of preventing, or at least significantly reducing, the transmission of sexually transmitted infections. Here is the latest research on microbicides.