PMID: 9190792Mar 1, 1997Paper

New allele-specific primers for detection of Leiden mutation in exon 10 of factor V gene in thrombophilias

Bioorganicheskaia khimiia
E S ZykovaE S Severin

Abstract

New allele-specific primers were developed which enable the facile and effective identification of the Leiden mutation in the human genome using PCR. One of the primers (allele-nonspecific), which is complementary to the nucleotide sequence of the intron 10 sense strand, [(5')TCTCTTGAAGGAAATGCCCCATTA], was described by B. Dahlback in 1994. Two other primers (allele-specific), (5')TAAGAGCAGATCCCTGGACAGCCA and (5')TAAGAGCAGATCCCTGGACACGCA), contained a 3'-terminal nucleotide corresponding to the nucleotide of the mutant allele, as well as a nucleotide noncomplementary to the template DNA near the 3'-end (shown by boldface type). When used in combination with allele-nonspecific primers, both allele-specific primers were equally effective in detecting the Leiden mutation in the human factor V gene. Using these primers, two Leiden mutations in the heterozygous state were found in 20 patients with deep vein thromboses and pulmonary thromboembolia.

Related Concepts

Related Feeds

Blood Clotting Disorders

Thrombophilia includes conditions with increased tendency for excessive blood clotting. Blood clotting occurs when the body has insufficient amounts of specialized proteins that make blood clot and stop bleeding. Here is the latest research on blood clotting disorders.