Polymerase chain reaction amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis

The Journal of Infectious Diseases
K D EisenachJ T Crawford

Abstract

A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR). The sequences of the primers (5' to 3') were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG, and a temperature of 68 degrees C was used for annealing the primers in the reaction. Amplification produced a 123-base-pair fragment with an internal SalI site. The specific PCR product was obtained with input DNA from 11 different strains of M. tuberculosis and Mycobacterium bovis and one strain of Mycobacterium simiae. No product was detected with DNA from 28 strains of the Mycobacterium avium complex, Mycobacterium scrofulaceum, Mycobacterium kansasii, Mycobacterium fortuitum, Mycobacterium chelonei, and Mycobacterium gordonae. The PCR product was detected by gel electrophoresis after 30 cycles using 1 fg of input DNA. Amplification of this sequence may provide the basis for an assay to detect M. tuberculosis directly in clinical material.

Citations

Oct 24, 2000·American Journal of Physical Anthropology·C J HaasA G Nerlich
Sep 1, 1995·American Journal of Physical Anthropology·B T ArriazaT A Holcomb
Aug 26, 2003·Journal of Clinical Laboratory Analysis·Sanjay K GargPrakash S Bisen
Jun 1, 1996·European Journal of Clinical Microbiology & Infectious Diseases : Official Publication of the European Society of Clinical Microbiology·J J PalaciosJ F de Quirós
Jul 1, 1996·European Journal of Clinical Microbiology & Infectious Diseases : Official Publication of the European Society of Clinical Microbiology·M A De FrancescoA Turano
Oct 1, 1992·European Journal of Clinical Microbiology & Infectious Diseases : Official Publication of the European Society of Clinical Microbiology·N RastogiP Cruaud
Dec 1, 1993·European Journal of Clinical Microbiology & Infectious Diseases : Official Publication of the European Society of Clinical Microbiology·A B AndersenN G Stoker
Oct 1, 1994·European Journal of Clinical Microbiology & Infectious Diseases : Official Publication of the European Society of Clinical Microbiology·S EhlersH Hahn
Nov 1, 1994·European Journal of Clinical Microbiology & Infectious Diseases : Official Publication of the European Society of Clinical Microbiology·M Salfinger, G E Pfyffer
Dec 1, 1994·European Journal of Clinical Microbiology & Infectious Diseases : Official Publication of the European Society of Clinical Microbiology·J PietrzakC Moroni
Jun 22, 2005·Virchows Archiv : an International Journal of Pathology·Christiane ScheweIver Petersen
Dec 12, 2012·Medical Molecular Morphology·Tomoyo Matsushita YamamotoKouichi Sano
Nov 24, 2004·European Journal of Clinical Microbiology & Infectious Diseases : Official Publication of the European Society of Clinical Microbiology·S M NakataniI J T Messias-Reason
Jan 4, 1993·Journal of Immunological Methods·L F BarreraD Radzioch
Jun 18, 1993·Journal of Immunological Methods·I KramnikD Radzioch
Dec 1, 1993·Journal of the Neurological Sciences·W LiedtkeC W Zimmermann
Aug 1, 1996·Molecular Aspects of Medicine·M J Colston
Sep 18, 1993·Lancet·J W SchneiderP D van Helden
Jun 30, 1994·Journal of Biotechnology·C Kessler
Aug 1, 1995·Diagnostic Microbiology and Infectious Disease·M G CormicanF Gannon
May 1, 1992·Research in Microbiology·J D van EmbdenP W Hermans
Feb 20, 2004·Diagnostic Microbiology and Infectious Disease·N Vijaya BhanuPradeep Seth
Jun 7, 2005·Diagnostic Microbiology and Infectious Disease·Alfred Lennart BissingerHolger Hebart
Jan 8, 1999·Comptes rendus de l'Académie des sciences. Série III, Sciences de la vie·E CrubézyD Montagnon
Dec 21, 2002·American Journal of Transplantation : Official Journal of the American Society of Transplantation and the American Society of Transplant Surgeons·Corey HendersonDavid Y Zhang
Oct 12, 2004·Modern Pathology : an Official Journal of the United States and Canadian Academy of Pathology, Inc·Stephan SchulzFalko Fend
Jun 26, 2001·International Journal of Dermatology·Y S LeeS C Lee
Dec 20, 2002·Journal of Veterinary Medicine. B, Infectious Diseases and Veterinary Public Health·M S Sulieman, M E Hamid
Sep 14, 2001·Respirology : Official Journal of the Asian Pacific Society of Respirology·A MertY Aktuglu
Nov 25, 2003·Respirology : Official Journal of the Asian Pacific Society of Respirology·Ali MertRecep Ozturk
Jan 1, 1992·Proceedings of the National Academy of Sciences of the United States of America·G T WalkerD D Shank
Mar 15, 1994·Proceedings of the National Academy of Sciences of the United States of America·W L SaloT A Holcomb
Jul 5, 2001·Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America·B M RothschildD Brittain
Jul 20, 2005·Clinical Infectious Diseases : an Official Publication of the Infectious Diseases Society of America·Philip A MackowiakJane E Buikstra
Apr 9, 2013·Surgical Infections·Yu-Hua HuangTao-Chen Lee

❮ Previous
Next ❯

Related Concepts

Trending Feeds

COVID-19

Coronaviruses encompass a large family of viruses that cause the common cold as well as more serious diseases, such as the ongoing outbreak of coronavirus disease 2019 (COVID-19; formally known as 2019-nCoV). Coronaviruses can spread from animals to humans; symptoms include fever, cough, shortness of breath, and breathing difficulties; in more severe cases, infection can lead to death. This feed covers recent research on COVID-19.

Blastomycosis

Blastomycosis fungal infections spread through inhaling Blastomyces dermatitidis spores. Discover the latest research on blastomycosis fungal infections here.

Nuclear Pore Complex in ALS/FTD

Alterations in nucleocytoplasmic transport, controlled by the nuclear pore complex, may be involved in the pathomechanism underlying multiple neurodegenerative diseases including Amyotrophic Lateral Sclerosis and Frontotemporal Dementia. Here is the latest research on the nuclear pore complex in ALS and FTD.

Applications of Molecular Barcoding

The concept of molecular barcoding is that each original DNA or RNA molecule is attached to a unique sequence barcode. Sequence reads having different barcodes represent different original molecules, while sequence reads having the same barcode are results of PCR duplication from one original molecule. Discover the latest research on molecular barcoding here.

Chronic Fatigue Syndrome

Chronic fatigue syndrome is a disease characterized by unexplained disabling fatigue; the pathology of which is incompletely understood. Discover the latest research on chronic fatigue syndrome here.

Evolution of Pluripotency

Pluripotency refers to the ability of a cell to develop into three primary germ cell layers of the embryo. This feed focuses on the mechanisms that underlie the evolution of pluripotency. Here is the latest research.

Position Effect Variegation

Position Effect Variagation occurs when a gene is inactivated due to its positioning near heterochromatic regions within a chromosome. Discover the latest research on Position Effect Variagation here.

STING Receptor Agonists

Stimulator of IFN genes (STING) are a group of transmembrane proteins that are involved in the induction of type I interferon that is important in the innate immune response. The stimulation of STING has been an active area of research in the treatment of cancer and infectious diseases. Here is the latest research on STING receptor agonists.

Microbicide

Microbicides are products that can be applied to vaginal or rectal mucosal surfaces with the goal of preventing, or at least significantly reducing, the transmission of sexually transmitted infections. Here is the latest research on microbicides.