Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children

Immunogenetics
Inna G OvsyannikovaGregory A Poland

Abstract

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to...Continue Reading

References

Feb 27, 1999·Current Opinion in Immunology·E B Kopp, R Medzhitov
Jan 5, 2000·Proceedings of the National Academy of Sciences of the United States of America·Y HeM G Rossmann
May 2, 2001·The EMBO Journal·A ReymondA Ballabio
May 12, 2001·Vaccine·S A Plotkin
Jan 16, 2002·American Journal of Human Genetics·Daniel J SchaidGregory A Poland
Mar 23, 2004·The Journal of Immunology : Official Journal of the American Association of Immunologists·Anja FuchsMarco Colonna
Dec 18, 2004·Human Immunology·Inna G OvsyannikovaGregory A Poland
May 4, 2006·The Journal of Clinical Investigation·David YenDonna Rennick
Feb 1, 2007·Disease Markers·Beena PuthothuMarcus Krueger
Mar 6, 2007·Seminars in Immunology·Gregory M Barton
Jul 24, 2008·Nature Reviews. Molecular Cell Biology·Yoshimi TakaiHisakazu Ogita
May 20, 2009·Pharmacogenomics·Gregory A PolandRobert M Jacobson
Dec 17, 2009·The Journal of Infectious Diseases·Inna G OvsyannikovaGregory A Poland
Oct 28, 2010·Transplant Infectious Disease : an Official Journal of the Transplantation Society·L ZhouS Zheng
Dec 7, 2010·Current Opinion in Immunology·Finlay W McNabAnne O'Garra
Jun 10, 2011·Biochemical and Biophysical Research Communications·Shanshan YuSidong Xiong
Jul 8, 2011·Omics : a Journal of Integrative Biology·Gregory A PolandRobert M Jacobson
Nov 4, 2011·Nature·Michael D MühlebachRoberto Cattaneo
Nov 16, 2011·Pharmacogenetics and Genomics·Inna G OvsyannikovaGregory A Poland
Feb 19, 2013·Human Immunology·Inna G OvsyannikovaGregory A Poland
Jan 1, 2014·Immunologic Research·Nathaniel D LambertGregory A Poland
Jan 7, 2014·Clinical and Vaccine Immunology : CVI·Nathaniel D LambertGregory A Poland
Apr 15, 2014·Vaccine·Emily Sydnor, Trish M Perl
May 20, 2014·Vaccine·Inna G OvsyannikovaGregory A Poland

❮ Previous
Next ❯

Citations

Oct 6, 2016·Immunologic Research·Ronald Moura RodriguesSergio Crovella
Jun 23, 2020·American Journal of Reproductive Immunology : AJRI·Wan-Ju KungChing-Chiang Lin
May 3, 2019·The Pharmacogenomics Journal·Adrià AteridoAntonio Julià
Nov 17, 2020·Vaccine·Stephen N CrookeRichard B Kennedy
Mar 20, 2021·Trends in Biochemical Sciences·Jaclyn QuinMary A O'Connell

❮ Previous
Next ❯

Related Concepts

Trending Feeds

COVID-19

Coronaviruses encompass a large family of viruses that cause the common cold as well as more serious diseases, such as the ongoing outbreak of coronavirus disease 2019 (COVID-19; formally known as 2019-nCoV). Coronaviruses can spread from animals to humans; symptoms include fever, cough, shortness of breath, and breathing difficulties; in more severe cases, infection can lead to death. This feed covers recent research on COVID-19.

Blastomycosis

Blastomycosis fungal infections spread through inhaling Blastomyces dermatitidis spores. Discover the latest research on blastomycosis fungal infections here.

Nuclear Pore Complex in ALS/FTD

Alterations in nucleocytoplasmic transport, controlled by the nuclear pore complex, may be involved in the pathomechanism underlying multiple neurodegenerative diseases including Amyotrophic Lateral Sclerosis and Frontotemporal Dementia. Here is the latest research on the nuclear pore complex in ALS and FTD.

Applications of Molecular Barcoding

The concept of molecular barcoding is that each original DNA or RNA molecule is attached to a unique sequence barcode. Sequence reads having different barcodes represent different original molecules, while sequence reads having the same barcode are results of PCR duplication from one original molecule. Discover the latest research on molecular barcoding here.

Chronic Fatigue Syndrome

Chronic fatigue syndrome is a disease characterized by unexplained disabling fatigue; the pathology of which is incompletely understood. Discover the latest research on chronic fatigue syndrome here.

Evolution of Pluripotency

Pluripotency refers to the ability of a cell to develop into three primary germ cell layers of the embryo. This feed focuses on the mechanisms that underlie the evolution of pluripotency. Here is the latest research.

Position Effect Variegation

Position Effect Variagation occurs when a gene is inactivated due to its positioning near heterochromatic regions within a chromosome. Discover the latest research on Position Effect Variagation here.

STING Receptor Agonists

Stimulator of IFN genes (STING) are a group of transmembrane proteins that are involved in the induction of type I interferon that is important in the innate immune response. The stimulation of STING has been an active area of research in the treatment of cancer and infectious diseases. Here is the latest research on STING receptor agonists.

Microbicide

Microbicides are products that can be applied to vaginal or rectal mucosal surfaces with the goal of preventing, or at least significantly reducing, the transmission of sexually transmitted infections. Here is the latest research on microbicides.