Structure and chromosomal assignment of the human cyclin G gene

Genomics
Y EndoH Nojima

Abstract

Human cDNA and genomic DNA encoding cyclin G were cloned and analyzed. The amino acid sequence of cyclin G is well conserved among mammals. Human cyclin G (295 amino acids) has one extra Thr at residue 6 compared with rat and mouse cyclin G (294 amino acids). The genomic DNA for human cyclin G consists of six exons, and in the first intron, one distinct putative binding site for the p53 tumor suppressor gene product (GCACAAGCCCAGGCTAGTCC) was detected. We performed chromosome mapping utilizing the fluorescence in situ hybridization (FISH) technique using both cDNA and genomic DNA for cyclin G. FISH localizes human cyclin G to the 5q32-q34 region. In the vicinity of the chromosomal location of human cyclin G, four cases of chromosomal translocations in human hematopoietic tumors have been reported, such as a subgroup of chronic myelomonocytic leukemia, non-Hodgkin lymphoma, and acute lymphocytic leukemia. It is therefore important to examine whether chromosomal translocations around this region cause aberrant cyclin G expression in a manner that is causally related to leukemia.

Citations

Nov 21, 2009·Technology in Cancer Research & Treatment·Uma Chandrachud, Susannah Gal
Aug 8, 1998·Hepatology : Official Journal of the American Association for the Study of Liver Diseases·M R JensenS S Thorgeirsson
Jan 6, 2009·Journal of Cellular and Molecular Medicine·Laura GramantieriMassimo Negrini
May 14, 2019·International Journal of Oncology·Yu-Yu LiuKoichi Matsuda
Jul 9, 1997·Biochemical and Biophysical Research Communications·H TsurugaH Nojima

❮ Previous
Next ❯

Related Concepts

Related Feeds

B-Cell Lymphoma

B-cell lymphomas include lymphomas that affect B cells. This subtype of cancer accounts for over 80% of non-Hodgkin lymphomas in the US. Here is the latest research.

Blood And Marrow Transplantation

The use of hematopoietic stem cell transplantation or blood and marrow transplantation (bmt) is on the increase worldwide. BMT is used to replace damaged or destroyed bone marrow with healthy bone marrow stem cells. Here is the latest research on bone and marrow transplantation.

Cell Checkpoints & Regulators

Cell cycle checkpoints are a series of complex checkpoint mechanisms that detect DNA abnormalities and ensure that DNA replication and repair are complete before cell division. They are primarily regulated by cyclins, cyclin-dependent kinases, and the anaphase-promoting complex/cyclosome. Here is the latest research.