PMID: 6171775Oct 10, 1981Paper

The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

Nucleic Acids Research
I KumagaiT Oshima

Abstract

Using 3'- and 5'-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most similar to Thermusaquaticus 5S RNA with which it shows 85% homology.

References

Jan 1, 1979·Proceedings of the National Academy of Sciences of the United States of America·H Hori, S Osawa
Apr 1, 1979·Proceedings of the National Academy of Sciences of the United States of America·D A Peattie
Aug 10, 1979·Nucleic Acids Research·R C Gupta, K Randerath
Aug 1, 1977·Nucleic Acids Research·H Donis-KellerW Gilbert
Oct 12, 1978·Nature·T E England, O C Uhlenbeck
Aug 7, 1975·Nature·G E Fox, C R Woese
Nov 1, 1977·Analytical Biochemistry·G Volckaert, W Fiers
Jan 1, 1972·Molecular & General Genetics : MGG·V A Erdmann, H G Doberer
Apr 15, 1970·Biochimica Et Biophysica Acta·J G ZeikusT D Brock
Nov 25, 1980·Nucleic Acids Research·H HoriH Ishikura
Jan 10, 1981·Nucleic Acids Research·V A Erdmann

❮ Previous
Next ❯

Citations

Jan 1, 1983·Bio Systems·A B McQuade
Dec 1, 1983·Journal of Biomolecular Structure & Dynamics·V A ErdmannT Pieler
Jan 22, 1982·Nucleic Acids Research·V A Erdmann
Nov 25, 1982·Nucleic Acids Research·N Delihas, J Andersen
Jan 11, 1983·Nucleic Acids Research·V A ErdmannR De Wachter
Feb 11, 1983·Nucleic Acids Research·H KüntzelU Hahn
Feb 24, 1984·Nucleic Acids Research·N UlbrichV A Erdmann
Jan 1, 1978·Nucleic Acids Research·V A Erdmann
Jan 1, 1985·Nucleic Acids Research·V A ErdmannR De Wachter
Jan 1, 1984·Nucleic Acids Research·V A ErdmannR De Wachter

❮ Previous
Next ❯

Related Concepts

Trending Feeds

COVID-19

Coronaviruses encompass a large family of viruses that cause the common cold as well as more serious diseases, such as the ongoing outbreak of coronavirus disease 2019 (COVID-19; formally known as 2019-nCoV). Coronaviruses can spread from animals to humans; symptoms include fever, cough, shortness of breath, and breathing difficulties; in more severe cases, infection can lead to death. This feed covers recent research on COVID-19.

Blastomycosis

Blastomycosis fungal infections spread through inhaling Blastomyces dermatitidis spores. Discover the latest research on blastomycosis fungal infections here.

Nuclear Pore Complex in ALS/FTD

Alterations in nucleocytoplasmic transport, controlled by the nuclear pore complex, may be involved in the pathomechanism underlying multiple neurodegenerative diseases including Amyotrophic Lateral Sclerosis and Frontotemporal Dementia. Here is the latest research on the nuclear pore complex in ALS and FTD.

Applications of Molecular Barcoding

The concept of molecular barcoding is that each original DNA or RNA molecule is attached to a unique sequence barcode. Sequence reads having different barcodes represent different original molecules, while sequence reads having the same barcode are results of PCR duplication from one original molecule. Discover the latest research on molecular barcoding here.

Chronic Fatigue Syndrome

Chronic fatigue syndrome is a disease characterized by unexplained disabling fatigue; the pathology of which is incompletely understood. Discover the latest research on chronic fatigue syndrome here.

Evolution of Pluripotency

Pluripotency refers to the ability of a cell to develop into three primary germ cell layers of the embryo. This feed focuses on the mechanisms that underlie the evolution of pluripotency. Here is the latest research.

Position Effect Variegation

Position Effect Variagation occurs when a gene is inactivated due to its positioning near heterochromatic regions within a chromosome. Discover the latest research on Position Effect Variagation here.

STING Receptor Agonists

Stimulator of IFN genes (STING) are a group of transmembrane proteins that are involved in the induction of type I interferon that is important in the innate immune response. The stimulation of STING has been an active area of research in the treatment of cancer and infectious diseases. Here is the latest research on STING receptor agonists.

Microbicide

Microbicides are products that can be applied to vaginal or rectal mucosal surfaces with the goal of preventing, or at least significantly reducing, the transmission of sexually transmitted infections. Here is the latest research on microbicides.