PMID: 7031603Oct 10, 1981Paper

Yeast deRNA viral transcriptase pause products: identification of the transcript strand

Nucleic Acids Research
V E BrennanJ Bruenn

Abstract

ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3' terminus of L is the initiation site of transcription and that a number of pause products are made. One prominent product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH.

References

Dec 1, 1977·Proceedings of the National Academy of Sciences of the United States of America·E C Koper-ZwarthoffJ F Bol
Sep 1, 1978·Proceedings of the National Academy of Sciences of the United States of America·H M Fried, G R Fink
Apr 1, 1979·Proceedings of the National Academy of Sciences of the United States of America·D A Peattie
Dec 1, 1977·Proceedings of the National Academy of Sciences of the United States of America·J C AlwineG R Stark
Oct 1, 1976·Nucleic Acids Research·J Bruenn, B Keitz
Sep 1, 1972·Analytical Biochemistry·R de Wachter, W Fiers
Sep 1, 1980·Proceedings of the National Academy of Sciences of the United States of America·P S Thomas
Apr 1, 1980·Cell·J A Bruenn, V E Brennan
Jul 11, 1980·Nucleic Acids Research·J BruennW Held
Jun 11, 1980·Nucleic Acids Research·J D WelshR B Wickner
Jun 11, 1980·Nucleic Acids Research·D Welsh, M J Leibowitz

❮ Previous
Next ❯

Citations

Mar 1, 1989·Virus Genes·T H ChangY Koltin
Nov 11, 1982·Nucleic Acids Research·D J Thiele, M J Leibowitz
May 11, 1983·Nucleic Acids Research·L J FieldY Koltin
Jun 1, 1984·Microbiological Reviews·D J Tipper, K A Bostian
Sep 1, 1989·Journal of Virology·M E DiamondJ A Bruenn
Jan 1, 1984·Molecular and Cellular Biology·B S Ben-TzviA Tamarkin

❮ Previous
Next ❯

Related Concepts

Trending Feeds

COVID-19

Coronaviruses encompass a large family of viruses that cause the common cold as well as more serious diseases, such as the ongoing outbreak of coronavirus disease 2019 (COVID-19; formally known as 2019-nCoV). Coronaviruses can spread from animals to humans; symptoms include fever, cough, shortness of breath, and breathing difficulties; in more severe cases, infection can lead to death. This feed covers recent research on COVID-19.

Blastomycosis

Blastomycosis fungal infections spread through inhaling Blastomyces dermatitidis spores. Discover the latest research on blastomycosis fungal infections here.

Nuclear Pore Complex in ALS/FTD

Alterations in nucleocytoplasmic transport, controlled by the nuclear pore complex, may be involved in the pathomechanism underlying multiple neurodegenerative diseases including Amyotrophic Lateral Sclerosis and Frontotemporal Dementia. Here is the latest research on the nuclear pore complex in ALS and FTD.

Applications of Molecular Barcoding

The concept of molecular barcoding is that each original DNA or RNA molecule is attached to a unique sequence barcode. Sequence reads having different barcodes represent different original molecules, while sequence reads having the same barcode are results of PCR duplication from one original molecule. Discover the latest research on molecular barcoding here.

Chronic Fatigue Syndrome

Chronic fatigue syndrome is a disease characterized by unexplained disabling fatigue; the pathology of which is incompletely understood. Discover the latest research on chronic fatigue syndrome here.

Evolution of Pluripotency

Pluripotency refers to the ability of a cell to develop into three primary germ cell layers of the embryo. This feed focuses on the mechanisms that underlie the evolution of pluripotency. Here is the latest research.

Position Effect Variegation

Position Effect Variagation occurs when a gene is inactivated due to its positioning near heterochromatic regions within a chromosome. Discover the latest research on Position Effect Variagation here.

STING Receptor Agonists

Stimulator of IFN genes (STING) are a group of transmembrane proteins that are involved in the induction of type I interferon that is important in the innate immune response. The stimulation of STING has been an active area of research in the treatment of cancer and infectious diseases. Here is the latest research on STING receptor agonists.

Microbicide

Microbicides are products that can be applied to vaginal or rectal mucosal surfaces with the goal of preventing, or at least significantly reducing, the transmission of sexually transmitted infections. Here is the latest research on microbicides.